                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGATGGCAGCATCATCGACGAGTTAACCTATGATGACTATCTTAAGCTGGAGGAATC
CGGGGAGTGCAGTTTTGTAGGTGTGAACCACACCGCAGGATTCATCATAGTTGACGGT
GATGGTGTTTTTAGATATTTCATGAGTCCCACTGAGGATGGATGGAAGAGGGGTCAGC
GTCAGGTTGCCGAGACTATTCTCCAGTACATTCTAAAACTGGTGGAGGAGAGGAAATA
GtgtttagaaaacctattaatcgcttttcgcgcatgctagatatcttacaaagggggatccacgggtaATG

    APE1722 Gene: APE1722     GI: 14601584     BI number: APE1722     GOG: COG0526,COG0785     Description: hypothetical protei GA G  A AT GC GC TG CG G  G A  |                 AT A  |                C  C TG                 T  A TA         A       T  T CG       A  C      A  A |  T       GC       G  G T  G       TA        GT A  C       GC        AT TA        TA        CG CG        GC       |  A AT        GC        GC GT       A  |       CG T  |       TG        CG AT        GC        AT GT        TA        CG TG        TG       |  A AT        TG        AT TA        TA        CG CG        GT        CG CG        AT        AT                         GTTTTTAGATATTTCATGAGTCCCACTGAGGATGGATGGAAGAGGGGTCAGCGTCAGGTTGCCGAGACTATTCTCCAGTACATTCTAAAACTGGTGGAGGAGAGGAAATAGtgtttagaaaacctattaatcgcttttcgcgcatgctagatatcttacaaagggggatccacgggtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here [O] COG0785 Cytochrome c biogenesis protein ... can be seen here     ..................................................................................................................