Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -7.33 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcaagctttaaacacacctccacatactaagtacctccccccagtataaattagagggttagtagctggcgtggtctgtaaaacttcaagtataagcgga
ggagcattacttccgggataacccacttatattcgcttctcccccgtccttgccttaccccccggaagtatagacaaaagcctattaccactaaattgaa
atttttgtcaccctctcagggtttgcacggtaatttttggttaccatagcttccgggagggggcgcgaccccttttgtccccgcattatgacctattctc
ATG

    APE1789


Gene: APE1789     GI: 14601626     BI number: APE1789     GOG: -------     Description: hypothetical protei


  t
c  c
t  a
 cg
 cg
 cg
 at
|  t
c  t
 tg         t
 gc       t  t
 ta       t  g
t  c       tg
t  |       at
t  |       at
t  |       ta
a  |       gc        gg
a  |       gc       g  a
a  |      |  a       cg
g  |      c  t       cg
t  |      a  a       tg
t  |       cg        tg
a  |       gc        cg
a  |      t  t       gc
a  |      t  |      a  g
t  |      t  |      t  c
c  |       gt       a  |
a  |       gc       c  |
 cg        gc       c  |
 cg       a  |      a  |
 at        cg        tg
 ta        tg        ta
 ta        cg        gc
 at        ta        gc
                        ccttttgtccccgcattatgacctattctcATG
    ..................................................................................................................