                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-19.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCTAAACCTGCTGTCTGCTATAGCAGCTGGCCAGCTGGCGAGGGCACACGAACTCC
TCGGCAGAGGCGGCCTAAAGATAAGCTAAtatctattaaaccccgatattttaagctgttacagccacttttgctaaag
gcagggctggtgtttattggttgaaagagccgtatcgccccggggagagtctgttttcggcttcctctccgagggctcccgaaagagcgtctacggtagt
aatatagagctttccgcgactgacgacagcctagtttacgagaggcttgacgacagtggtaacGTG

    APE1868 --- APE1867 Gene: APE1868     GI: 14601683     BI number: APE1868     GOG: COG2430     Description: hypothetical protein Gene: APE1867     GI: 14601682     BI number: APE1867     GOG: COG0668     Description: hypothetical protei   a a  a t  c t  c a  c t  c cg ta at ta At At |  t |  t |  a Ta Cg Gc At A  g T  | A  | G  | A  | At At         a Ta       a  a |  c      t  g C  a       cg Cg        gc Gc        ta Gc        tg C  a      t  | Gc       t  | Gt       c  | At       a  | Gt        cg At        cg Cg        gc Gc        at Gt        cg             gtgtttattggttgaaagagccgtatcgccccggggagagtctgttttcggcttcctctccgagggctcccgaaagagcgtctacggtagtaatatagagctttccgcgactgacgacagcctagtttacgagaggcttgacgacagtggtaacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2430 Uncharacterized conserved protein ... can be seen here [M] COG0668 Small-conductance mechanosensitive channel ... can be seen here     ..................................................................................................................