                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.56 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTGGGGAGTGGCGTAGAGCCCGTGGGCTCCGTGTTCGCTAAGCAGGTTGTGGGCGGA
GACGAGGGTTTGAGGCCGGGCGACGAGGCTATAGTGGTGGACGAGGAGGATAGGCTGC
TGGGCGTGGGTAGGGTGAGGATACCCCTAGCTTTTATAAGGGGGCTTGACAGGGGAGA
GGTTGTTAGGCTCCAGTAAacggggggttctacggtttggtcgaggagattaagattgtcagcgatctgtccaaggatgagctgga
gggcgccacggtagtcaccggcttccgcggcttcgggctgGTG

    APE2018 Gene: APE2018     GI: 14601785     BI number: APE2018     GOG: COG1938     Description: hypothetical protei AG G  G CG AT GT AT |  G        G         G G  A      G  A      T  A G  G      A  G      G  G CG       G  G      G  G GC       C  A      G  A GC       A  T       AT |  G      G  A       TA G  G      G  G       GC TG        TG        GC GC        GC       G  | TG       G  T      T  | TA       T  G      G  | GC        GC       C  | |  G       AT        GC G  A       TG        GC A  G      A  |       GT CG        TG        TA GC        CG        CG AT        GC        GC                         TTTTATAAGGGGGCTTGACAGGGGAGAGGTTGTTAGGCTCCAGTAAacggggggttctacggtttggtcgaggagattaagattgtcagcgatctgtccaaggatgagctggagggcgccacggtagtcaccggcttccgcggcttcgggctgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1938 Archaeal enzymes of ATP-grasp superfamily ... can be seen here     ..................................................................................................................