                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-10.92 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACACAGACGATCTCGGGATGACATGGCTGCCCCAGCTTTTCGTCCAGCTGGAGGACGG
CAGTGTAAAGCTTGTAATGAGCCAATTCCCCTTCGACCCCGCGACAGGCAAAAGCGAT
CCCGAGAGGGCCTACCAGGAGGCCAAGACTAGGATAGGGGAGATAGAGAGGGACCCCT
AAcactggcgttcgtggccggggtattattttccaccccacaagcccccaatagaattggggggcgggtttgaagggttccgacgctacactcctctcc
tttcaactcctagacgtctcgtacgagATG

    APE2098 Gene: APE2098     GI: 14601842     BI number: APE2098     GOG: COG0417     Description: DNA-directed DNA polymeras CA C  G A  G TA CG         A CG       G  G GC       A  A GC       T  G |  A      A  G |  A      G  G       cg G  G      A  A      g  t A  A       GC       g  t GC        GC       t  c AT        GC        cg |  A       GC        at |  G       AT        cg |  G       TA       A  g |  A      |  A      A  c |  T      A  c      T  c G  A      G  a       Cg CG        Gc        Cg CG        At        Cg CG        Tg        Cg TG        Cg        At                         attattttccaccccacaagcccccaatagaattggggggcgggtttgaagggttccgacgctacactcctctcctttcaactcctagacgtctcgtacgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0417 DNA polymerase elongation subunit (family B) ... can be seen here     ..................................................................................................................