                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=1 nt.   Size=19 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-19.30 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggttaggtttatgaacttcaagccttaaagttttgttggggattccccaatatgagctacataacgaagagatatggcttagataggcattcaacatcag
cctatctaatagctctacgcggtatagaaagatacagtcagatacagaaagttacagcttagtttttctgccccagctgggggctcccagccggacactc
aagagcaaatacatgctgcgtaaagtagcatctttattaggaacagggtctagtttgaatgccagtgtgacaacggtggtaccagttgtccagcgggaga
GTG

    APE2267 Gene: APE2267     GI: 14601955     BI number: APE2267     GOG: COG0076     Description: glutamate decarboxylas            gc           g  t            gc            gc            gc            ta            cg            gc           a  c            cg            cg           |  a           |  c           |  a           |  c           c  t           c  c           g  a            ta            cg            ta            tg           |  c            ta            ta            ta         a            gt       t  a   c       |  a      g  a g  t      a  c       cg a  g      t  a       gt cg       t  t       ta cg        cg        cg cg        gc        gc cg        at        ta gc        cg        at                         ctttattaggaacagggtctagtttgaatgccagtgtgacaacggtggtaccagttgtccagcgggagaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0076 Glutamate decarboxylase and related PLP-dependent proteins ... can be seen here     ..................................................................................................................