                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtggaggtggtccgggggcgggggaccctaaTGGTCCCGCCGCGGGGATTCGAACCCCGGACCACCCGGT
gtctgcggggagacaccgggttacgccgcccgcgtcccactacagccgggcgctctgccgctgagctacggcgggaccactattctaaaccaatttctgg
aacctataaggtttgaagccgtccactctactgtaacgtgtccccctggtaggcatgtaatagctttcccccgccaaatatcctggatgggcgatgagga
taggcgggcttttctgagacgtgtgatgaGTG

    APE2289 Gene: APE2289     GI: 14601971     BI number: APE2289     GOG: COG1839     Description: hypothetical protei at a  a tg gc |  t |  t t  t a  c       gg c  c      g  c gc       t  g gc       a  a a  c      g  t t  g      g  g gc        ta gc        cg ta        cg |  a       ta |  a       at |  t       ta |  a      a  | |  t      a  | c  c      a  | c  c       cg c  t       cg cg        gc cg        cg ta        cg gt        cg             cttttctgagacgtgtgatgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1839 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................