                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAAAGGGTTCTGGAGTCCTCTAGGCCTGGGGGCATGCAGGGAGCCCCAGGTAGCACC
GATGACCAGCCCCTCCTACGTACTGTAGggcccctcggctaggggagccggcctgcacatcaacgcctcccgccgggag
gcgtcatgactccgccatacgcctcacaggggccccctatatagcagtgtctttgagaacaggatgaattaggctttaagctgggggagagccacgtggt
gccccctctattttactgtggaatggggctaaggagtattagggggcgcttattcatatccgaGTG

    APE2340 Gene: APE2340     GI: 14602007     BI number: APE2340     GOG: -------     Description: hypothetical protei            cg           a  t tg        cg c  g       cg g  g       gt a  g      a  g a  g      g  | ta       a  | tg        gc ta        gc cg        gc gc        gc gc        gc             tctattttactgtggaatggggctaaggagtattagggggcgcttattcatatccgaGTG     ..................................................................................................................