                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -7.56 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCGGGAACCCGCAGCCCTCGCACTCCCACACCTCGCCGTCGGCGTACCCCAGCTTAA
TGGTCATGCCCCGCCTAATCTCCTCGCTGTGCCTCATAGTCCAGACTCCCGTGAGCGC
CTGTACGAGCGTGGTCTTGCCGTGGTCGACGTGGCCTACTACTCCAATGTTGACCTCA
GGCTGACGCTTGTCTCCACCGCTCAAGGCGCTAAACCCGGGCATaataggggtttggctggagggta
taaagaaggtggggctgcctggcctcccgcttgtTTACTCCTCCTTGTCGCCGTAGTGGATG

    APE2372 Gene: APE2372     GI: 14602025     BI number: APE2372     GOG: -------     Description: hypothetical protei             a           t  t           g  a           g  a           g  a           a  g   T       g  a A  a      g  a C  a       tg G  t       cg G  a       gt G  g      g  g Cg        tg Cg        tg Cg        tg At        gc At       g  | At       g  | Tg       g  |       cc Cg       a  |      g  t Gc       t  |       tg C  t      a  |       cg G  g      a  |       gc G  |      T  |       gc A  |       At        gt A  |       Cg        gc Cg        Gc       t  | Ta        Gc        gc Cg        Gt        gc                         gcttgtTTACTCCTCCTTGTCGCCGTAGTGGATG     ..................................................................................................................