                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=74 nt.     Delta G=-19.23 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttcctaggcctagggagctagccaagtcacttgaagtccagggggaggagtggatagcactccttgagagtgggggaggcctacagcataggagcaggt
actctttcctagcgtggggcaggagaaagtcgagtgaaacagacgctatcagggcgtatgaggaactcgagcgcttagcggacgataagtgcagggcgct
gccttgccgcagccccacgttctttctggtatcctatgaggctgttgtcggtgaggagccgtggctatcgcggctggttggtaggcatgagtggccaggt
ATG

    APE2553 --- APE2555 Gene: APE2553     GI: 14602142     BI number: APE2553     GOG: COG0147     Description: anthranilate synthase component I Gene: APE2555     GI: 14602143     BI number: APE2555     GOG: COG0512     Description: anthranilate synthase component I   c t  a a  g tg cg gc cg at g  a at cg a  a a  g a  g g  a ta gc at gc cg         t ta       a  a g  |      g  a a  |       cg a  |       at a  |      g  | g  |      g  | a  |       cg g  |       gc g  |      a  a a  |      t  g c  |       tg g  |       cg g  |       gc g  |       cg g  |       gc        tg tg        at       t  c gc       g  g      c  c cg       c  |       cg gc       t  |       gc at       c  |       ta |  t      a  |       cg |  a      a  |       gc |  g       gc       c  | t  c       gc        gc cg        at        gc cg        gt        gc                         acgttctttctggtatcctatgaggctgttgtcggtgaggagccgtggctatcgcggctggttggtaggcatgagtggccaggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here     ..................................................................................................................