                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTAGACGCTCTTCCCCGAGAACATTCCAGAGTCCACTAGGACTGTTGACGCTCCGTC
TGTGAAGGCGTAGACATTGACGCTCCCGAGATCACCTATGGGGATCCAAGCCTCGACC
CTAAATGGCATCCCGCCAAACACccatcctcaacacccctggtaacggcatggccgaagaaatatagaggagtcgctggggcg
agtttaaactccctctttgcaataacaatatatatgaccggaacaatatatatgactggcttcttaagcccggaggtcgggggtgggttttcttgtcaac
aGTG

    APE2583 Gene: APE2583     GI: 14602159     BI number: APE2583     GOG: COG1301     Description: proton/sodium-glutamate symport protei ta t  a ta gc at gc c  |       gg gc       c  a gc       c  a gt       a  c gc       g  a        g |  t       ta       a  c |  t       at       a  c t  t       ta       t  c cg        at        tg gc        ta        cg c  a       at        ta ta        ta        tg gt        at        cg a  a      a  g       gt g  a      c  a       gc g  c      a  c       tg a  a      a  t       cg g  a      t  g      a  g at       a  |      g  g ta       a  |       tg at        cg        at ta        gc        tg                         ggttttcttgtcaacaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1301 Na+/H+-dicarboxylate symporters ... can be seen here     ..................................................................................................................