                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:32 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G= -8.61 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAGAAGCCTTATAAACAGGTCGCCCAAGGGCTTGAGATCGACCATCACTCCCCCGAT
AACGATACCAGCAATTATCCCGAGTACGAACCCAACAGCTATCTTGTATAGAACCGGA
ATCTCTATGTAACGCCTAAACACtgttgacaagaaaacccacccccgacctccgggcttaagaagccagtcatatatattgtt
ccggtcatatatattgttattgcaaagagggagtttaaactcgccccagcgactcctctatatttcttcggccatgccgttaccaggggtgttgaggatg
gGTG

    APE2585 Gene: APE2585     GI: 14602160     BI number: APE2585     GOG: COG0491     Description: hypothetical protei            cc           c  a            cg            gc            cg            ta           c  |           a  |           a  |           a  |           t  |           t  | ta       t  | t  a       gc ta        at gc       g  | at        gc gc        gc |  g       at gc        gc gc        at             atatttcttcggccatgccgttaccaggggtgttgaggatggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................