                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-11.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctacgtagcccagcttgcgaggccaggcgaggtctatgaggtggtgatgagggatccagacacgtggctggctgtccagagaatagcagaggatatggg
tttcgaggtcctcgaggcgggtcggagagacggcgagaaagtctactatgtgagaatacggctggctgtatagaggtcgcggctcagatctccagtggta
gtgccgtaggagTTATGAGAAGTTATGGAGTGCCGGGGAGAAACTTTGATTCCTGTGCAACTC
CTTTTTCATTAGTAGTTGCAAATAGGTTTGGCGTTCCATG

    APE2592 Gene: APE2592     GI: 14602164     BI number: APE2592     GOG: COG1744     Description: hypothetical protei            TG           A  A       CT            TG       A  T   g        TA       A  T a  t      g  A      A  G t  g      a  G      G  A gc       g  |       AT gc        gT        GT tg        aT        GC g  t       tA        GC a  a       gT        GT cg        cG        CG cg        cG       |  T ta       g  A       CG cg       t  G       GC t  T      g  |      |  A a  T       aT        TA g  A       tG        GC aT        gC        AT cG        gC        GC tA        tG        GC                         TTTTTCATTAGTAGTTGCAAATAGGTTTGGCGTTCCATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1744 Uncharacterized ABC-type transport system, periplasmic component/surface lipoprotein ... can be seen here     ..................................................................................................................