                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G=-22.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAGGAAAGCCCCTAGAACGCCCAGCCACACCACAAGAACCATGAGGAAGAGTATGT
AGCTTAGGAAGACCCTCCTAAACCCTCTGCTTAGAATGTCGAATAGTACCCTCAAGTC
ATCCCGTGGAAGGCCGTCCGCCATCATGCAACACCGCACaagccagcaggcctgttggaacgctagtaaga
ggtcgaaacccgtctatgcatccttagccaccccaggtaataaggggggagtgggagatggaggcccaggttatcaacggggcacggccacctaatatcc
cgggtgtgcttctTTG

    APE1336m Gene: APE1336m     GI: 14602204     BI number: APE1336m     GOG: COG1233     Description: phytoene dehydrogenas   a t  a g  t g  a a  a cg cg cg cg a  | cg cg g  a        t a  g      a  c t  t       ta tg        ta cg        gc cg       g  g ta       a  | a  |       cg c  |       cg g  |       cg t  |       gc a  |      g  a t  |      a  | cg       g  |       at ta        gc       a  a gt        tg       t  t cg       a  g      c  c cg       g  |      c  c c  a      a  |      a  c a  |      g  |       cg a  |       gc        cg a  |       gc       g  g g  |       ta        gt cg        gc        cg tg       a  |       at gc        gc        cg gc        gt        gc                         ttctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG1233 Phytoene dehydrogenase and related proteins ... can be seen here     ..................................................................................................................