Gene putatively regulated by attenuation in A_pernix
Characteristics of the secondary structures
Terminator: Distance from promoter:163 nt. Distance to gene:33 nt. Distance to run of Ts=3 nt. Size=30 nt. Delta G= -9.60 kcal/mol
Antiterminator: Distance from promoter:130 nt. Size=46 nt. Delta G= -3.46 kcal/mol
Anti-antiterminator: Distance from promoter:97 nt. Size=53 nt. Delta G=-17.30 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGAAA-TAAAAA. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGAAACTCTTTGTAGAGTAGAATAAAAACCTAATGAGCCTGTACACAGCCATGCACT
CATAAAACTGTACGTTATACTCTCTTTCGGAAACCCTGGTGTGCATacactcttccgataaacaat
actcccccgtcccagcttatcacatccacaggcgcgattaaccaggacggagggataatggtacacactactggcggaattataagatgcggccagtaaa
cttttattcccctagctggagaataagtgaataaatctgggtGCC
_v3
Gene: _v3 GI: APEtRNA03 BI number: APEtRNA03 GOG: ------- Description: tRNA-Se
c
a a
cg g
cg t g
t c a t
a g a a
c c t c
a | a a
cg g c
ta g a
at gc
t t at
t a g a
c a g | ta
g c c | a a
a c a | tg
c a g | ta
cg gc at
cg at a g
ta cg g c
gc cg g g
cg | c cg
cg a g gc
| a a g gc
cg ta ta
cg ta cg
cg at at
ta gt ta
aacttttattcccctagctggagaataagtgaataaatctgggtGCC
..................................................................................................................