                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-32.10 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-18.20 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTTTACGGCGTCGCCCACGTTGTCTCCTATCTCAGCCAGTTCATGTCGCTGCATCCC
GGCGATGTCATTTCCACCGGCACCCCTCCCGGCGTCGGCATGGGCCAAAAGCCGCCGC
GTTACCTGAAGACTGGTGACGTCGTGGAACTCGGCATCGAGGGCCTCGGTTCCCAGAA
GCAGACTTTCGTCGCTGACATCTGAtcgccggcaggcattcaacgaaaagtgaggcgccggcgggaaaccgctggcgcctta
aattttgtgcacctgcgaaaagctgctatggtcagaaaaagagcGTG

    AGR_C_24 Gene: AGR_C_24     GI: 15887374     BI number: AGR_C_24     GOG: COG4553     Description: AGR_C_24 TT T  C CG         a AT       a  a GC       g  a A  |       cg CG        at GC       a  | AT        cg        aa |  G       ta       g  a |  A       tg        gc |  C      a  |       gc |  A       cg        cg AT        gc        gc GC       g  |       gt AT       a  |       cg CG        cg        cg C  A       gc        gc C  t       gc        cg T  c       cg        gc Tg        cg        gc Gc        gc        at Gc        cg        gt Cg        tg        ta                         aattttgtgcacctgcgaaaagctgctatggtcagaaaaagagcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG4553 Poly-beta-hydroxyalkanoate depolymerase ... can be seen here     ..................................................................................................................