                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccgaaatagaggacatgaggtcttctggctcaaccgttatctccgccacggatgtactggcggcatttaacggacataaaaggcgggggtgaccccgctt
tttcttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatt
tgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctcc
ATG

    AGR_C_121 Gene: AGR_C_121     GI: 15887435     BI number: AGR_C_121     GOG: COG0679     Description: AGR_C_121             a           c  t           g  t           g  t           c  a           g  a            gc            tg            cg           a  |            ta        tg            gc       g  a   t        ta        gc a  g       at        gc g  t      g  a       gc g  a      g  a       gc c  c      c  a       cg at       a  a       gc cg        cg        gt cg        cg        at gc        gc        at cg        cg        at cg        cg        at                         cttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatttgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0679 Predicted permeases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-15.50 kcal/mol Antiterminator: Size=44 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:   Size=21 nt.     Delta G= -8.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ccgaaatagaggacatgaggtcttctggctcaaccgttatctccgccacggatgtactggcggcatttaacggacataaaaggcgggggtgaccccgctt tttcttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatt tgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctcc ATG     AGR_C_121 Gene: AGR_C_121     GI: 15887435     BI number: AGR_C_121     GOG: COG0679     Description: AGR_C_121             a           c  t           g  t           g  t           c  a           g  a            gc            tg            cg           a  |            ta            gc   c        ta a  a       at g  t      g  a g  g      g  a       tg a  a      c  a      g  a gg       a  a       gc ag        cg        gc tt        cg        gc ac        gc        gc at        cg        cg at        cg        gc                         tttttcttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatttgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0679 Predicted permeases ... can be seen here     ..................................................................................................................