                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-21.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGTCGTCAAGGAAGGGGACAAGGTCTGGGTCAAGCTGATGGGCTTTGATGAGCGCG
GCAAGGTTCGCCTGTCCATGAAGGTTGTCGACCAGGCAACCGGCAAGGAAGTGGCTGC
CGACAAGAAAGACGGCGAAGCCGCTGCCGAATAAggctgcgccgccagaccctatcgaggcgcgggttctgcccg
cgcctttttttcgtttttgttatcgtttgtcttttcgggaaaaccggtttccacttttccctgacaaactccatcctaccttgaggacgctccaatgagc
cgtgacgccGTG

    AGR_C_122 Gene: AGR_C_122     GI: 15887436     BI number: AGR_C_122     GOG: COG2813     Description: AGR_C_122 cc g  g c  c gc ta cg |  a gc gc A  c At Ta         c At       t  t |  c      t  g A  g       gc G  a       gc Cg        gc Cg        cg Gc        gc T  |       cg Cg        gc Gc        gc Cg        at Cg        gt             tttttcgtttttgttatcgtttgtcttttcgggaaaaccggtttccacttttccctgacaaactccatcctaccttgaggacgctccaatgagccgtgacgccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG2813 16S RNA G1207 methylase RsmC ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-21.00 kcal/mol Antiterminator: Size=45 nt.     Delta G=-16.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GACGTCGTCAAGGAAGGGGACAAGGTCTGGGTCAAGCTGATGGGCTTTGATGAGCGCG GCAAGGTTCGCCTGTCCATGAAGGTTGTCGACCAGGCAACCGGCAAGGAAGTGGCTGC CGACAAGAAAGACGGCGAAGCCGCTGCCGAATAAggctgcgccgccagaccctatcgaggcgcgggttctgcccg cgcctttttttcgtttttgttatcgtttgtcttttcgggaaaaccggtttccacttttccctgacaaactccatcctaccttgaggacgctccaatgagc cgtgacgccGTG     AGR_C_122 Gene: AGR_C_122     GI: 15887436     BI number: AGR_C_122     GOG: COG2813     Description: AGR_C_122 cc g  g c  c gc ta cg |  a gc gc A  c At Ta         c At       t  t |  c      t  g A  g       gc G  a       gc Cg        gc Cg        cg Gc        gc T  |       cg Cg        gc Gc        gc Cg        at Cg        gt             tttttcgtttttgttatcgtttgtcttttcgggaaaaccggtttccacttttccctgacaaactccatcctaccttgaggacgctccaatgagccgtgacgccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG2813 16S RNA G1207 methylase RsmC ... can be seen here     ..................................................................................................................