                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-21.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGTCAGGCACgctctgtccacttgatgcaactgcgatttgtcaaacggcaactatagacagtgccgacgatcatgccagcctttccgac
acggtaagggagaaaatgtggcagaggcggcacccaaagcggaagagcccggtaaaaccttgcaatcctgccccgatgggtctatatgacccctgaaatt
cttgatcgcttgatgaagagtggggccgcaaggctccgctctttttcgttaggcgaaccggaaaccacgggctaagtgcccggtgaaaatctaaagaccg
gaaggccagATG

    AGR_C_138 Gene: AGR_C_138     GI: 15887444     BI number: AGR_C_138     GOG: COG0779     Description: AGR_C_138   t a  a t  t       ct cg       g  t ta        cg gc        ta gc        at gc       g  g |  c       ta t  t       ta a  g       cg g  a       ta c  a       tg c  a       at        ca c  t      a  |      g  a c  t      a  |       cg g  c      g  |       cg t  t      t  |       gc c  t       cg        gt cg        cg        gc ta        cg        gc at        cg        tg a  c      a  c       gc cg        gc        at gc        tg        gc                         tttttcgttaggcgaaccggaaaccacgggctaagtgcccggtgaaaatctaaagaccggaaggccagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................