Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCTCGATCCCGATCGTCGGCGATTTCCAGAAGATGCTGGGCATGGATTCGCTGCTC
GTCGGCTTCGGCCTGACTGACGACCGCATTCATTCGCCGAATGAAAAATACGAGCTGC
AATCCTTCCATAAGGGCATCCGCTCCTGGGTCCGCATTCTGGACGCACTCGCAGCGAA
ATGAcaaaaaaaagaggaagcaccgggtaatccggcgcttcctcttttccgtttgcgcatcgcaaaaacaaaaaggccgggcgagcccgacctttcc
atccgtttttcgtcagtgccagtacatccGTG

    AGR_C_163


Gene: AGR_C_163     GI: 15887461     BI number: AGR_C_163     GOG: -------     Description: AGR_C_163


            G
          T  A
          A  c
          A  a
          A  a
          G  a
          C  a
          G  a
          A  a
  T       C  a
A  T      G  a
C  C       Cg         a
 GT        Ta       t  a
 CG        Cg       g  t
 CG       |  g       gc
 TA       |  a       gc
 GC       A  a       cg
G  G       Cg        cg
 GC        Gc       a  c
 TA       C  a       cg
C  C      A  |       gc
C  T       Gc        at
T  C       Gc        at
 CG        Tg        gc
 GC        Cg        gc
                        tcttttccgtttgcgcatcgcaaaaacaaaaaggccgggcgagcccgacctttccatccgtttttcgtcagtgccagtacatccGTG
    ..................................................................................................................