                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-29.00 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTCTTCTTGATCGCCTTTACGGGGACCGCCAATTTCGCAAGGGCGATGCACGCGAG
GAAGAAAAATCAATACAGCGACCAAACGTCACCACACCTTACCGATTTGTAAtccgctctt
cccttgaaaagccgcatttgcacacacatttcttagaggacggcgcctgatcacgccgtagtctgatagctggctcgtcccccgccgcgtcagaccggac
aaaggcctttccccctctccgggcctttgtcctccaatatgaccgccatggccgacccctcccggccatggcggttttattTTG

    AGR_C_167 --- AGR_C_165 Gene: AGR_C_167     GI: 15887463     BI number: AGR_C_167     GOG: COG1846     Description: AGR_C_167p Gene: AGR_C_165     GI: 15887462     BI number: AGR_C_165     GOG: COG0624     Description: AGR_C_165 cc                  cc c  t                c  t c  c       at       c  c c  t      a  a      a  c t  c      c  t       gc t  c       cg        cg tg        ta        cg cg       c  c       gc cg       c  c       gc gc        tg        ta gc        gc        at at       t  c       cg at       t  a       cg at       t  t       gc cg        cg        cg at        cg        cg gc        gc        at gc        gc        gt                         ttattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here     ..................................................................................................................