                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.31 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCCCGCTGCTGCTCGGTTTCGTGCTCGGGCCGCTGCTGGAGGAGAACCTGAGGCGC
GCGATGATCCTGTCGCGCGGAGATCCGACGACCTTCGTCACCCGGCCGATCAGCGCCA
CCCTGCTTTTCATCGCTCTGGCCGTTCTGATCATCGTCTTCCTGCCGAGCGTGAAGAA
GAAACGCGAAGAGGTTTTCGTCGAAGAAGACTGAgcagcatcaaaatgtgagacgccggcgatggaaacatcgct
ggcttttttgtgtctggtcagccgtgacgattcgcttcgcgaaagcgacatATG

    AGR_C_187 --- AGR_C_189 Gene: AGR_C_187     GI: 15887473     BI number: AGR_C_187     GOG: COG2900     Description: AGR_C_187p Gene: AGR_C_189     GI: 15887474     BI number: AGR_C_189     GOG: COG3803     Description: AGR_C_189             a           a  t           a  g            at            cg            ta           a  g           c  a           g  c           a  |            cg            gc           A  |            Gc            Tg            Cg           A  |       aa           G  |      g  a CG       A  |       gc T  A      A  |       ta G  A      G  |       at CG       A  |       gc TA       A  |       cg TA        Gc        gc TG        Cg        gt TA        Ta        cg GC        Gt        cg GT        Cg        gc                         ttttttgtgtctggtcagccgtgacgattcgcttcgcgaaagcgacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2900 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG3803 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................