                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:9 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGATGCGGATGCGACACCCAATCCGGGTGGCCTGCCGGTTGGCGGCAAGACCATGCT
CACTTTCCCCAACAACCACCTCTCCTACGCCGTGACATGGTATATTCTGGCGGCGATG
GTGGTGGCGGCCGGCTGGTATGTGCTACGCAACCTCAACGCACCGAAATCGAAACGGG
ATGCTGATTGAaccgctggttttaccggatggttcataaaagcgcttccttcttcacgttttgctgatctataacgacagttcggcctgaca
ttgccccgtcggcgcaattttgtttcggtgagctATG

    AGR_C_219 --- AGR_C_218 Gene: AGR_C_219     GI: 15887492     BI number: AGR_C_219     GOG: COG1015     Description: AGR_C_219p Gene: AGR_C_218     GI: 15887491     BI number: AGR_C_218     GOG: COG1816     Description: AGR_C_218 tt c  c c  t t  t       ta t  c      a  a c  a      t  c gc        cg cg        ta gt       a  | at        gc at        ta        gc at        cg       t  c a  g       gt       t  c t  c      t  t      a  c at       t  c       cg cg        tg        at ta        tg        gc t  t       gc        tg gc       c  c       cg gt        at       |  c ta        cg        cg at        ta        gc                         aattttgtttcggtgagctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1015 Phosphopentomutase ... can be seen here [F] COG1816 Adenosine deaminase ... can be seen here     ..................................................................................................................