                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACGGCTGACATCGACGACATCGGCGGCTCCGCACTTTACCTGCTGTCCAGCCTGTC
GCGCGGCGTGACCGGCGAATGTCATTACGTGGATTGCGGTTACAATATCACCTCGACG
CCCACGCTTGAGGTTCTGTCCAAGGCAGACGCGGAATAAgtcgtcttctgatattcgacaaaagcccggcc
atgtgccgggcttttttatgcgccgtatcaattttggaaatcactaaagtatagtttatcgaagtaactgaatttaaacatggggtggttatggtccgca
acaaattcaacggTTG

    AGR_C_240 --- AGR_C_239 Gene: AGR_C_240     GI: 15887502     BI number: AGR_C_240     GOG: COG4961     Description: AGR_C_240p Gene: AGR_C_239     GI: 15887501     BI number: AGR_C_239     GOG: COG4961     Description: AGR_C_239 tg c  a t  t t  a c  t t  t gc cg ta gc A  a A  a T  a A  a A  g        t Gc       a  g Gc       c  t C  |       cg Gc        gc Cg        gc |  g       cg |  c       cg A  c       cg G  a       gc At        at Cg        at             ttttatgcgccgtatcaattttggaaatcactaaagtatagtttatcgaagtaactgaatttaaacatggggtggttatggtccgcaacaaattcaacggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG4961 Flp pilus assembly protein TadG ... can be seen here [U] COG4961 Flp pilus assembly protein TadG ... can be seen here     ..................................................................................................................