                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:208 nt.    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=13 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:191 nt. Size=24 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:    Distance from promoter:147 nt.    Size=56 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCG-GAAATT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCGAAGGCGCCGCCGGTTTCGGAAATTTCGGTGATCCGGTGAACCATGAGCATGG
GGGGCAATGGGAGCTGGGCATTTCCCGGGCCGAACAATTCGCCGCGACCGCAGGACAG
GATCTCCTCGTAGTTGTAACTTGATTGCCTGGTTGCCATACCGCTTTCACTTCCCCAA
TCACTGGTGTTGAACGACTTCACtagagcaagttaggttcaaaatgaagcgctgcaagggcagaggccgctccggccccattc
tTTG

    AGR_C_247 --- AGR_C_249 Gene: AGR_C_247     GI: 15887507     BI number: AGR_C_247     GOG: -------     Description: AGR_C_247p Gene: AGR_C_249     GI: 15887508     BI number: AGR_C_249     GOG: COG0735     Description: AGR_C_249   t g  t a  a a  g cg gt at gc |  a a  a t  a C  a At Cg Ta Ta Cg A  |       ag Gc       a  g Cg        cg A  c       gc A  t       ta G  |       cg T  |      |  a Tg       |  g        t Gc       |  g      c  c Ta       |  c       gc G  a       gc        cg G  |       cg        cg Tg        gc        gc Cg        at        gc                         ccattctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0735 Fe2+/Zn2+ uptake regulation proteins ... can be seen here     ..................................................................................................................