                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=57 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGACAACTGTTTCAGGTTCATGTCTGTCATTTCCTCCATGCGCGCGCTCAGGAAAA
GGCTAAAAGCCACtcctcacattcccaaagcgctttagatttttaccagtcccatccgcttttctcaatcgaaaatgatagccgcctttcg
aaataaatacgacttttaccgcagcgccacagcgtttctgccaaaagagcctcttgactccatctcgaagacaatgagatgaataggtagccaaagcgct
ttgattggaagaggacgctttgagccttttatgtgatgggaggtaaatcacATG

    AGR_C_1045 Gene: AGR_C_1045     GI: 15887936     BI number: AGR_C_1045     GOG: COG1653     Description: AGR_C_1045             a           g  c           a  a           a  a            gt            cg            ta            cg            ta            at           |  g           |  a           |  a ac       |  t c  a      |  a       tg cg        cg       t  g gc        cg       a  a cg       |  t      g  a |  t       ta        tg |  t       cg        ta |  t      a  c       tg gc        gc        cg at        ta       |  a cg        ta        gc gc       c  |       cg c  c       ta        gc c  a       cg        at a  a      |  c       at ta        cg        at ta        gc        cg tg        at       |  a ta        gt        cg cg        at        gc                         cttttatgtgatgggaggtaaatcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................