                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGGCAGGAGCCGATCATCGTCAAGGTGCCGGGCATTGTTTCCGTCGGCAAGGGAGAA
ACATTGCGGTTTGCCGCGCCCCAGGAAAAGCTTCACCTCTTTGATGCCGCGGGCAAGA
CTTACCGCCCATAAgggaccgaaataaaaaccccggaacatccctgttccggggtttttatggcttttttgcctcctgtggaaaaccatc
ggaaatgtcccgcttccggcctgtttaagagcgccctgatatgaattgttaaagactatggcctagtctcgacccatcgattgagcatgggagtATG

    AGR_C_1054 Gene: AGR_C_1054     GI: 15887941     BI number: AGR_C_1054     GOG: -------     Description: AGR_C_1054 GA A  C A  T C  T G  A GC GC CG GC C  C       aa C  |      a  a GC       t  a TA       a  c AT       a  c       cc G  A      a  c      t  c TA        gc        at Tg        cg        cg Tg        cg        at Cg       |  a       at Ta       |  a       gc C  c      |  c       gc C  c      |  a       cg A  |       at        cg Cg        gc        cg Ta        gc        cg Ta        gc        at                         ttttatggcttttttgcctcctgtggaaaaccatcggaaatgtcccgcttccggcctgtttaagagcgccctgatatgaattgttaaagactatggcctagtctcgacccatcgattgagcatgggagtATG     ..................................................................................................................