                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGTGAGAGGTATATCGCGCGGGTACGTGACTTGGCGAAAGCCTGCGGCGAAGCCTT
CCTGCTGACGGATGCCGGCGGGCTGAACTGGAACAGGGCCGCCTGAttttcgagggcagtttcacg
ccaaagtttcaataaatttgaaaggccgttcttgacggccttttattttgtgttgattgttccagggaaaaatcagcatggatttgattatgaatattag
aagcttacgctttttgcccgtattgatgctcggatgtcttcttagtaacgcggcggctgccgaaacaaccgaatggATG

    AGR_C_1136 Gene: AGR_C_1136     GI: 15887981     BI number: AGR_C_1136     GOG: -------     Description: AGR_C_1136             a           a  a           t  t            at            at            cg            ta            ta            ta           g  |           a  | CC       a  | G  G      a  | GC        cg GC        cg AT        gc CG       c  c |  A      a  |        t |  t      c  |      c  t |  t      t  |       tg At       t  |       ta At       t  |       gc Gc       g  |       cg G  g      a  |       cg Ta        cg        gc Cg        gt        gc A  g       gt        at A  g       gc        at Gc        at        at Ta        gt        gt Cg        cg        ta                         ttttgtgttgattgttccagggaaaaatcagcatggatttgattatgaatattagaagcttacgctttttgcccgtattgatgctcggatgtcttcttagtaacgcggcggctgccgaaacaaccgaatggATG     ..................................................................................................................