                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-23.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCCGATGCGTGAAAAGAACAATGCGGGCGCCATGCGCCACGCGACAGCCAAGCCGA
AAGAACGCAACGAGGGGTCGCAATCCGGTGGTGCTCTCGCCGCCGCTTTGGCCGAAGC
CATGAAGCGACGCTGAcctctggttgaattgttttttgaccaaaaagccccgccggacacgccggcggggctttttgcttgatgaaat
cgttcaatttttttgaaataagactatcttgaaacttgtgctgaaaggaatacggtcagcaaaattgataagtgagacttagcaattgggggtgccATG

    AGR_C_1155 Gene: AGR_C_1155     GI: 15887991     BI number: AGR_C_1155     GOG: COG2230     Description: AGR_C_1155            ac           g  c            ta            ta            ta            ta            ta            tg            gc         a           t  c      c  c           t  c      a  g gt       a  c       gc t  t      a  |       gc t  t      g  |       cg at       t  |       cg at        tg        gc g  t       gc        cg t  g       gc        cg ta        tg        cg gc        cg        cg gc        ta        gc                         tttttgcttgatgaaatcgttcaatttttttgaaataagactatcttgaaacttgtgctgaaaggaatacggtcagcaaaattgataagtgagacttagcaattgggggtgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2230 Cyclopropane fatty acid synthase and related methyltransferases ... can be seen here     ..................................................................................................................