                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-19.41 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-21.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGTTGGCGCAGCCATCACCTGGAAGGTCACCGAAAACGCGGAAGTTGGCTCGTTC
GCGGAATATCGCCGCCTGATGGGCGATGCCGCCGACAGCTCGCTGGTGCGCGAACGCG
GTTCGAAGAACCAGTTCATCGTCGGCGTTCAGGCCAGCTACAAGTTCAATTTCTCGCT
GCCCTGAggggacgggcgataaccacatgtgaagccccgttgcgaagccgctgcggggcttttttgcatgcgggcggggtgctgaaatccattcc
gatttttttgccaatgctgtagaaccatcgcATG

    AGR_C_1159 Gene: AGR_C_1159     GI: 15887993     BI number: AGR_C_1159     GOG: COG0382     Description: AGR_C_1159             t           c  t           g  t            gt            gt            gt            cg            gc            ta           |  t            cg            gc ag        cg a  c       cg gc       g  |       tg cg       a  |      c  a gc       a  |      g  a t  t      g  |       ta tg       c  |       gt gc       g  |       gc cg       t  |       gc cg        tg       g  a cg        gc       c  t cg        cg        gt gc        cg        gc at        cg        gc at        cg        cg                         atttttttgccaatgctgtagaaccatcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0382 4-hydroxybenzoate polyprenyltransferase and related prenyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.40 kcal/mol Antiterminator: Size=29 nt.     Delta G= -6.50 kcal/mol Anti-antiterminator:   Size=68 nt.     Delta G=-19.13 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGCGTTGGCGCAGCCATCACCTGGAAGGTCACCGAAAACGCGGAAGTTGGCTCGTTC GCGGAATATCGCCGCCTGATGGGCGATGCCGCCGACAGCTCGCTGGTGCGCGAACGCG GTTCGAAGAACCAGTTCATCGTCGGCGTTCAGGCCAGCTACAAGTTCAATTTCTCGCT GCCCTGAggggacgggcgataaccacatgtgaagccccgttgcgaagccgctgcggggcttttttgcatgcgggcggggtgctgaaatccattcc gatttttttgccaatgctgtagaaccatcgcATG     AGR_C_1159 Gene: AGR_C_1159     GI: 15887993     BI number: AGR_C_1159     GOG: COG0382     Description: AGR_C_1159   C T  A T  A G  T A  T A  T C  C A  T T  C CG GC AT CG C  C GC GC AT CG TA |  g |  g |  g |  g        c Ta       a  a Gc       c  t       ag Cg        cg       a  c G  |       at        gc G  |      a  g       cg Cg       t  a       gc Tg       a  a      t  t Gc       g  |       tg Cg        cg        gc Ta        gc        cg At       |  c       cg C  |       gc        cg Ta        gc        cg Ta        cg        gc Gc        at        at                         tttttgcatgcgggcggggtgctgaaatccattccgatttttttgccaatgctgtagaaccatcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0382 4-hydroxybenzoate polyprenyltransferase and related prenyltransferases ... can be seen here     ..................................................................................................................