                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G=-19.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGAGCTGGCGGTGAACCGTGCCGCGAGGCTGACCGCTTGCCTCGACGACATCGGTAA
AACGCATCGGCTTTTCGGCAAGGGCGATCAGTTCCAGCAGCGAGACGACCTTGCCGAG
CGTGCCGGTGGCGTTTTCGGTTTTCTGGTGTGAGGGCGGAACCGCATCGGGCTTTCCG
CCATTGGCTTTTTTATCATCAGGCATGCGCCATCCACCGTCATCGGTCTTGACATCAT
CGAGACGCCAAGAGAATAATTCCACttagtaaaatttagttccaaataatggaacaatcaagcctttcATG

    AGR_C_1273 --- AGR_C_1271 --- AGR_C_1269 --- AGR_C_1268 Gene: AGR_C_1273     GI: 15888049     BI number: AGR_C_1273     GOG: COG1028     Description: AGR_C_1273p Gene: AGR_C_1271     GI: 15888048     BI number: AGR_C_1271     GOG: COG3734     Description: AGR_C_1271p Gene: AGR_C_1269     GI: 15888047     BI number: AGR_C_1269     GOG: COG0800     Description: AGR_C_1269p Gene: AGR_C_1268     GI: 15888046     BI number: AGR_C_1268     GOG: COG3386     Description: AGR_C_1268 AA T  A G  A GC CG T  C A  A        G C  |      C  A AT       A  C GC        GC CG        AT |  G       GT |  C       CG |  T       GC A  T      A  C G  T      C  | C  T      G  | T  C      A  | CG       C  | CG        CG GC        TA TA        TG |  A       GC |  G      A  G        G TG       C  |      G  T CG       T  |       CG GC       A  |       CG CG        GT        GC C  A       CG        TG AT        GC       G  T GC        GC       C  T TA       G  G       GT CG       A  G       AT GT        AT        GC GT        CG        CG                         GTTTTCTGGTGTGAGGGCGGAACCGCATCGGGCTTTCCGCCATTGGCTTTTTTATCATCAGGCATGCGCCATCCACCGTCATCGGTCTTGACATCATCGAGACGCCAAGAGAATAATTCCACttagtaaaatttagttccaaataatggaacaatcaagcctttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here [G] COG3734 2-keto-3-deoxy-galactonokinase ... can be seen here [G] COG0800 2-keto-3-deoxy-6-phosphogluconate aldolase ... can be seen here [G] COG3386 Gluconolactonase ... can be seen here     ..................................................................................................................