                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.41 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-25.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTTTTGCGATGGCGGTCAAGCTCTCATCGGAGTTCATTTCGGCCATCGTGGTCGGCG
CTATGCTGGGTTATCTTCTGGACTATTTTGTCGGCACGACGCCGTGGGGGATGATCGT
TCTTCTTCTTCTCGGTTTCTGCGCAGGCGTATTGAATGTGTTGCGCTCGACGGGCGCG
GTGGCCAAGCCGCCGCTGCTGGAGAAGGCGGACAGACAGGACGAGGGTGGAAAAGGCG
GCGCTTAAgctgttttttcttgcagttgagatgccgcgatgcgcggcgacaggtaaagagggcagccgGTG

    AGR_C_1295 Gene: AGR_C_1295     GI: 15888058     BI number: AGR_C_1295     GOG: COG0356     Description: AGR_C_1295   A C  A CG GC GC         A TG       G  C GC       A  A GC       C  G CG       A  G GC       G  A C  T       GC G  G       CG GC       |  A GT       |  G CG       |  G A  G      G  G G  A      G  T CG       A  G TA       A  G |  A      G  A       TT |  G      A  A      C  A CG       G  A      G  A GC       G  A       Cg CG        TG        Gc G  |       CG        Gt TG        GC        Cg TA        TG        Gt GC        CG        Gt TA        GC        At                         tttcttgcagttgagatgccgcgatgcgcggcgacaggtaaagagggcagccgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0356 F0F1-type ATP synthase, subunit a ... can be seen here     ..................................................................................................................