                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-19.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACCATGATGCTCGGTTATGCCGGCTGGGGTCCGGGCCAGCTGGAAAACGAGATCGC
CAATAATGGCTGGCTGAATTGCCCGGCGGCGGAAGAGCTGATCTTCGACCGTGGTCTG
GACAATAAATATGAGCGGGCGCTGGCCCTGATGGGCGTCGATGCCCGTATGCTCTCCA
CGGATGCCGGGCACGCCTGAgcccattttgttctcgattgttttttgctggaaccaaatcctgatccctgacgttactcacccgg
aaagccgaacagaaagtacggcttaactagggagaagtaaaATG

    AGR_C_1429 --- AGR_C_1431 Gene: AGR_C_1429     GI: 15888125     BI number: AGR_C_1429     GOG: COG3237     Description: AGR_C_1429p Gene: AGR_C_1431     GI: 15888126     BI number: AGR_C_1431     GOG: COG4307     Description: AGR_C_1431 GA T  T CG CG CG GC |  G |  T GC TG C  A GT CG GC GC GC |  G |  T       CA |  A      C  C |  T       TG CG        CG GC        TA AT       |  T GC        CG T  |       GC        AC A  |      T  |      C  G T  |      A  |       GC A  |      T  |       GC A  |       GC        GT A  |       CG        CG T  |       CG       |  A A  |       CG        Cg A  |       GC        Gc C  |       TA       T  | AT       A  |      A  | GC        GC        Gc GC        CG        Gc                         attttgttctcgattgttttttgctggaaccaaatcctgatccctgacgttactcacccggaaagccgaacagaaagtacggcttaactagggagaagtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3237 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG4307 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:93 nt.     Distance to run of Ts=3 nt.   Size=17 nt.     Delta G= -6.50 kcal/mol Antiterminator: Size=35 nt.     Delta G=-12.80 kcal/mol Anti-antiterminator:   Size=30 nt.     Delta G=-10.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGACCATGATGCTCGGTTATGCCGGCTGGGGTCCGGGCCAGCTGGAAAACGAGATCGC CAATAATGGCTGGCTGAATTGCCCGGCGGCGGAAGAGCTGATCTTCGACCGTGGTCTG GACAATAAATATGAGCGGGCGCTGGCCCTGATGGGCGTCGATGCCCGTATGCTCTCCA CGGATGCCGGGCACGCCTGAgcccattttgttctcgattgttttttgctggaaccaaatcctgatccctgacgttactcacccgg aaagccgaacagaaagtacggcttaactagggagaagtaaaATG     AGR_C_1429 --- AGR_C_1431 Gene: AGR_C_1429     GI: 15888125     BI number: AGR_C_1429     GOG: COG3237     Description: AGR_C_1429p Gene: AGR_C_1431     GI: 15888126     BI number: AGR_C_1431     GOG: COG4307     Description: AGR_C_1431            TG           A  C            GC            CC GA        TG T  T      |  T CG        GA CG        CT CG       G  | GC       G  | G  G      G  | T  T       TG        AC C  |       AC       C  G GC        GT        GC CG        TC        GC G  A       CT        GT G  |       CC        CG GT       C  |      |  A CG        GC        Cg GC        GA        Gc                         ccattttgttctcgattgttttttgctggaaccaaatcctgatccctgacgttactcacccggaaagccgaacagaaagtacggcttaactagggagaagtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3237 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG4307 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................