                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:209 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=28 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGGCCGCCCCATCCCCAATGAAGAAATGATGACGCGCCTCGAGGACATCACCCGGG
AGCGCCTGACCGATCTTGCAGGCCGGCTATTTTTCGATACAGTTCCGACATTGTCTGC
CATTGGCCCGCTGGAACAGCTGCCGCCGCTTTCAGACATCACTGCCGCGCTGTCCGCG
CAGCAGCCTGCAAGGATAAAGGCGAACGGATAAaccactatgagagcgggacttaaaggcgaagaccgctcatctt
tttcgccgtcccgcttgcggatggcgatatctgccgcccagggatcgtgaATG

    AGR_C_1436 --- AGR_C_1434 Gene: AGR_C_1436     GI: 15888128     BI number: AGR_C_1436     GOG: COG1670     Description: AGR_C_1436p Gene: AGR_C_1434     GI: 15888127     BI number: AGR_C_1434     GOG: COG2199,COG2200,COG2202     Description: AGR_C_1434 AT        AT C  C      G  C A  A      C  T GC       C  T GC       A  G A  |       GC GC        TA CG        CG TG        CG CG        GC |  A      |  C CG       |  G GC        CG CG        GC GC        AT             ATTTTTCGATACAGTTCCGACATTGTCTGCCATTGGCCCGCTGGAACAGCTGCCGCCGCTTTCAGACATCACTGCCGCGCTGTCCGCGCAGCAGCCTGCAAGGATAAAGGCGAACGGATAAaccactatgagagcgggacttaaaggcgaagaccgctcatctttttcgccgtcccgcttgcggatggcgatatctgccgcccagggatcgtgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1670 Acetyltransferases, including N-acetylases of ribosomal proteins ... can be seen here [T] COG2199 FOG: GGDEF domain ... can be seen here [T] COG2200 FOG: EAL domain ... can be seen here [T] COG2202 FOG: PAS/PAC domain ... can be seen here     ..................................................................................................................