                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGGTGTCGCAGGCCATCACCCGCCGTCGCAAACCGCAGCCCCTGCGTGGTGATGCG
GCAAAACGTCTCGATGACATGATGGAAGGCCTCGAGAGCGAGGCATTGCGCAAGGCGG
TGGAACGGCTTGGCACGGCGGTCTTGCAGAAGAAGCCGCGTGGCCGAAGCATTTGAtc
ggtgcggttgtccttgactggtcacaattctttgacaagaagagtccagaactccgcttgtgatgaacaggccgtcgctatatcggaatcaacggacaat
agagtctattaccaacaggtgctttcATG

    AGR_C_1464 --- AGR_C_1466 Gene: AGR_C_1464     GI: 15888143     BI number: AGR_C_1464     GOG: COG1651     Description: AGR_C_1464p Gene: AGR_C_1466     GI: 15888144     BI number: AGR_C_1466     GOG: COG1196     Description: AGR_C_1466 CA G  G TA TA         T CG       A  T TA       C  T G  A      G  G G  |      A  A       tg CG        At       t  t GC        Gc        gc GC        Cg        gc CG        Cg       |  t A  C       Gt       c  t CG       G  |      g  g GT       T  |       ta G  |      G  |       gc T  |       Cg        gt TG        Gc        cg CG        Cg        tg GC        Cg        At GC        Gt        Gc CG        At        Ta                         caattctttgacaagaagagtccagaactccgcttgtgatgaacaggccgtcgctatatcggaatcaacggacaatagagtctattaccaacaggtgctttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1651 Protein-disulfide isomerase ... can be seen here [D] COG1196 Chromosome segregation ATPases ... can be seen here     ..................................................................................................................