                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.50 kcal/mol

                                                                        Nomenclature/Definitions

CACCTGCAACTGCCGACGCCGCCGCAGATCGATCTCGAGGCGCTGAAGGGTGCCGGCG
CGGCGCCTGCGGGTGCGCCGGTGAAGAAGGTGCCGGATATCGCGCTTTAAggtttagctgcga
aatttaagattggacgccgcgtgtctctggatgcgcggcgtttttgttggaggcgacttcttaatatccaacgcatccggttccatttacagtcgcacgg
tccctgcaggcgccgaaaatgatggaatcgcaatccagctagtagtaataattgctaccaactgcgaaggagatcatagATG

    AGR_C_1484 --- AGR_C_1483 Gene: AGR_C_1484     GI: 15888153     BI number: AGR_C_1484     GOG: COG3609     Description: AGR_C_1484p Gene: AGR_C_1483     GI: 15888152     BI number: AGR_C_1483     GOG: COG3668     Description: AGR_C_1483           ct          t  g           cg           ta           gt           tg           gc           cg           gc           cg           cg           gc           cg           at           gt             tttgttggaggcgacttcttaatatccaacgcatccggttccatttacagtcgcacggtccctgcaggcgccgaaaatgatggaatcgcaatccagctagtagtaataattgctaccaactgcgaaggagatcatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG3609 Predicted transcriptional regulators containing the CopG/Arc/MetJ DNA-binding domain ... can be seen here [R] COG3668 Plasmid stabilization system protein ... can be seen here     ..................................................................................................................