                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgccacggacgacgtccgctggtaatgctcagagcggttcaacacgtttcgagaaaggaggcttcgcatggatatttcctgcttctggcgcaatcgtcag
ctctgccacctttttgccctgcagacacgtttgcagggctgaccggaacaccaacactctggtttgcccaaaaggccgcgcagaatgcagcttgtctgcc
attgcgcctgttttcacgacggatcactacgaaccgaaacccggtactgcctgtggcagaccacggttcttgacgggtccgtcctgccagagacgacatc
ATG

    AGR_C_1553 Gene: AGR_C_1553     GI: 15888191     BI number: AGR_C_1553     GOG: COG0488     Description: AGR_C_1553 ca c  a a  c c  a a  c at gc gt cg cg at gt t  t cg                   t gc                 t  g gc                 c  t gc                  gc |  a                 at |  a        g        cg |  a      a  a       gc |  a      c  a      t  c a  g       gt       a  a cg        cg       a  | gc        gc        gt t  c      c  a       at t  |       cg        cg tg        gc        gc gc        gt        cg cg        at        gc                         ctgttttcacgacggatcactacgaaccgaaacccggtactgcctgtggcagaccacggttcttgacgggtccgtcctgccagagacgacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:183 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G= -6.60 kcal/mol Antiterminator: Size=46 nt.     Delta G=-10.30 kcal/mol Anti-antiterminator:   Size=28 nt.     Delta G= -4.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tgccacggacgacgtccgctggtaatgctcagagcggttcaacacgtttcgagaaaggaggcttcgcatggatatttcctgcttctggcgcaatcgtcag ctctgccacctttttgccctgcagacacgtttgcagggctgaccggaacaccaacactctggtttgcccaaaaggccgcgcagaatgcagcttgtctgcc attgcgcctgttttcacgacggatcactacgaaccgaaacccggtactgcctgtggcagaccacggttcttgacgggtccgtcctgccagagacgacatc ATG     AGR_C_1553 Gene: AGR_C_1553     GI: 15888191     BI number: AGR_C_1553     GOG: COG0488     Description: AGR_C_1553             a           c  t           g  g            cg            ta           t  t           c  a            gt ga        gt a  a       at g  a       gc        aa cg        gc       c  t tg        at        gc ta       a  g       cg tg       a  |       gt |  g       gc        gc |  c       at        ta |  t       gt        cg |  t      c  c      |  c gc       t  t      |  t cg        tg       t  c Gc        tg       t  t Ta        gc        cg At        cg        gc                         cacctttttgccctgcagacacgtttgcagggctgaccggaacaccaacactctggtttgcccaaaaggccgcgcagaatgcagcttgtctgccattgcgcctgttttcacgacggatcactacgaaccgaaacccggtactgcctgtggcagaccacggttcttgacgggtccgtcctgccagagacgacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................