                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgcggctgatgcacgacccTTAAAAATCAACGCGGATTTTGTAAAAAGTCATGTCCGAATGAATGC
GTAACTGGCATGCTTTGGCCGTTCCTCGCGAAAGCGGCCTTTTCATagtctggttgtgatgatctt
ataagggcagtttcaaggcgcaacaactgcttgatggcgatgaagaaaaaccgcttgatgaaagttgccgcaccattcatggccgcttgaatgcggcact
ggattgttttacgttgacgttaacgtcagttattcgatgttggcgtcgtttttcaacaggaggcaagaATG

    AGR_C_1577 Gene: AGR_C_1577     GI: 15888203     BI number: AGR_C_1577     GOG: NOG07177     Description: AGR_C_1577 ga        tg t  a      t  a       ta t  t       gc       t  t cg        cg       g  t gc        at       a  c cg       t  t       cg cg       t  |       ta gc        ta        gt g  a       ta        cg t  c       gc        at at       t  g       at cg       t  |       tg tg       a  |       tg ta        gt        gc at        gc        cg c  t       ta        at cg        cg        gc at        at        tg                         tttttcaacaggaggcaagaATG     ..................................................................................................................