                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-22.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.89 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTGCTCGGGCAACTATTCCAAGGTTTCGCCTGTCGTGAAGCTGGATGACCGCGAATT
GCAGGCGGGCCCGGTCGCGCGCAAGGCGCTTGATCTCTATATGGATTGGGCACGTCTC
GGCGCAGACGTCTGAaatccgcatacattgcgttaaacgcggccatggcaggcattcgtccggtcatggccgtttttgttgcggcgcaa
aaaaatccccaaaaagatgggggagtttaatccaattttagacaagcttattttagtttgcggcatcttcatttccggctagcgggggccgccagATG

    AGR_C_1595 Gene: AGR_C_1595     GI: 15888213     BI number: AGR_C_1595     GOG: COG0840     Description: AGR_C_1595            gc           t  g           t  t           a  t           c  a           a  a       tt           t  a      a  c           a  c       cg            cg        gt            gc        gc            cg       |  c CG        cg       a  g A  T      |  c       cg GC       |  c       gt AT        ta        gc CG        at        ta |  A      a  g       at |  a      A  g       cg G  a       Gc        cg C  t       Ta        gc Gc        Cg        gc Gc        Tg        cg Cg        Gc        gt                         ttttgttgcggcgcaaaaaaatccccaaaaagatgggggagtttaatccaattttagacaagcttattttagtttgcggcatcttcatttccggctagcgggggccgccagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................