                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=56 nt.     Delta G=-15.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAGCCGGGACGCAGGATGTAACCGACGCCGCGCTCGCCTTCGATCGGCACACGCAT
GGTCTGAAGCGCGGCGATATCGCGATAGACCGAGCGCGCGGTCACCTCCAGCATGTCA
GCAATTGTCTGCGCGGTCACCGGGCGGCGCGCCAGCCGCAGGATCTGGATGATCTCGA
ACAGTCTCGACGCCTTGCGCATATTGTACATTTCCATGTGATAGGGCGACACAACTGA
CACAACGTTGTCAGTTGGCATtttttataagcggaaaaacacattgagaaacaaatgctttcccgaatGTG

    AGR_C_1604 Gene: AGR_C_1604     GI: 15888220     BI number: AGR_C_1604     GOG: COG1280     Description: AGR_C_1604   C A  A T  T G  T T  T T  C A  C TA AT CG GT CG |  A GT TA TG CG CG        AC GC       A  G CG       C  T A  A       AT G  C       CG C  A       AT T  C       GC C  A       TA TA        CG GC        AT AT        AT CG        CG             GCATtttttataagcggaaaaacacattgagaaacaaatgctttcccgaatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1280 Putative threonine efflux protein ... can be seen here     ..................................................................................................................