                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGCCCGCTGCCACGATTTTCATCGGCCGCGCCGCAGGCTTTCTGCTGATTGCCGCC
GCCCTCTTGACTTTTTGGGAGGCATTTTCCTGGAGCATGGGCGAATGAttgaggatgtcgcgca
atttcagccagccgtcagatacgtgccataaagccaatcccggccccgcaccggagcctcgtctagacttctgttttcacggcggaattcaccgcaatgt
gacttcttttcgccatccggaaagggcatcctcgcccggttcgataaagcgccggtgtccatgccggaatcaaggagaGTG

    AGR_C_1607 Gene: AGR_C_1607     GI: 15888221     BI number: AGR_C_1607     GOG: COG3909     Description: AGR_C_1607 tc a  c a  c cg cg gc a  c a  c a  c t  | a  | c  | cg gc ta |  c gc cg |  g       tc |  a      t  t       tt |  g       cg       a  c |  c       at       a  a |  c       gt        gc |  t       at        gc a  c      |  t       cg tg       |  c       gc at       |  a      |  a gc       t  c      |  a at        cg       g  t |  a       tg        cg cg        gc        at ta        cg        cg gc        tg        ta                         cttcttttcgccatccggaaagggcatcctcgcccggttcgataaagcgccggtgtccatgccggaatcaaggagaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG3909 Cytochrome c556 ... can be seen here     ..................................................................................................................