                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-15.60 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACGCATCGTCTCCCATTGCCACGGCCATTCGATCGAGGATTGTTACGTCATCCGCG
CGCTTTCCAACCACGGTATGTGCGAGGGCGAGCATTGAaccgctaaagcgggcttgacagaatatggattcg
ggcgcattgcattccccatgatcaacgaacgcgcacccatctcctgctcgtatttttgggccttcctttaagggcggctcgacagatcatattgtcaaca
agccgccgtcaggcggctttgttgttttcaaacgtcctgacggcaccgataagaccaaaggaccgaaaaaATG

    AGR_C_1617 --- AGR_C_1616 Gene: AGR_C_1617     GI: 15888227     BI number: AGR_C_1617     GOG: COG0454     Description: AGR_C_1617p Gene: AGR_C_1616     GI: 15888226     BI number: AGR_C_1616     GOG: COG0693     Description: AGR_C_1616   t        ca t  a      t  t t  a      a  a cg        gt cg        at tg        cg t  c       at        tc cg        gc       g  a cg       |  a       cg gc       |  a       cg gt       |  c       gc gc       c  a       cg tg        ta        cg ta        cg        gc |  c       gc       |  t ta        gc        at tg        cg        at ta        gc        cg at        gc        at                         tgttttcaaacgtcctgacggcaccgataagaccaaaggaccgaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here [R] COG0693 Putative intracellular protease/amidase ... can be seen here     ..................................................................................................................