                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=2 nt.   Size=19 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-14.20 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggaactttcggcacctgcgtcaaatgcggcaagaggatttcggaggatcggctgaaggcggtgccttacacgccgttttgccaggaatgcgctgcggctt
tgtgagggtaattccggagtgcgaggtcgcctcccgtttcttctctccgccgggataagaaacaagcagcgaccactcgttataccggcgctggatggct
caagcgaaatgaaacctctcctttcactacaacctcgaacgcaatttgatcgccgttaaccggccgctgtcttgttcctgtctaatattgccttcatgct
TTG

    AGR_C_1653 Gene: AGR_C_1653     GI: 15888244     BI number: AGR_C_1653     GOG: COG1272     Description: AGR_C_1653            ag           g  g           t  g ga        gt g  a       ta at        ta cg       t  t |  c      c  t cg        gc gc        gc t  t       cg t  |      g  g t  |       ta tg        cg gc        gt cg        cg cg        gc        gg gc        tg       a  t |  t      a  a       gc c  t      a  |       cg at       g  |       gc cg       g  |      t  | at       a  |       gc tg        cg        at ta        cg        gc cg        gt        gc                         cgtttcttctctccgccgggataagaaacaagcagcgaccactcgttataccggcgctggatggctcaagcgaaatgaaacctctcctttcactacaacctcgaacgcaatttgatcgccgttaaccggccgctgtcttgttcctgtctaatattgccttcatgctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1272 Predicted membrane protein, hemolysin III homolog ... can be seen here     ..................................................................................................................