                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAACCCAGCACGCGGGTGGCGCCATTTTCCGGCGACTGGTTGCGGCGCACCTTGGT
GTCCACAGGGTTCACCGAAACCGCCTTCACCTCCACCAGAATGTCGTGCCCCTTGGCT
TCCGGCTGGGCCAGATCGATGTCGATGAGGGCATCCGCCGCGGTGATGGGCTGGCTGG
TTTTGTAACCGATGGCGCGCATgaacagtctcctttgcttgtttgcgtgcctcttacttgatacatatgaacatcaatcgcaag
aatgcacattttgtggtgatacatacaaaaaggatactgtagATG

    AGR_C_1831 Gene: AGR_C_1831     GI: 15888340     BI number: AGR_C_1831     GOG: COG1733     Description: AGR_C_1831            TG   C       A  T T  C       GC T  G       CG CG        TA GC        AT GT       |  G T  |      G  A T  |      A  G C  |       CG CG        CG CG        GC CG       |  A       GA GC        GT       T  T |  C       GC       G  G |  A      T  C      G  G |  G       CG        CG |  A       GC        GC T  T       GC       |  T GC        CG        CG CG       C  C       CG TA       T  |       GC GT        TG       |  T TG        CG        CG AT        GT        CG                         TTTTGTAACCGATGGCGCGCATgaacagtctcctttgcttgtttgcgtgcctcttacttgatacatatgaacatcaatcgcaagaatgcacattttgtggtgatacatacaaaaaggatactgtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1733 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................