                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.80 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-21.90 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGATCTGATGACACTGAAGGCCGAAATCGGGCGCGATCCGAGCGAGCGCCCTGTGC
GTCACGCTGAAGGTCCGGAGACGGTCTGAtaccggttcaggcaccgctgacttttaaaacgcgtccgttgaaaaacggg
cgcgtttttgtttgtgccgacggccggagtaaaatttgcatttaaacttaacaaacatcaaatccggccagtcgaaattatatcttggttaattttagac
gtgtctaaatcacgcaaagacaccagcgacatgaattggggtgtcagagcaggatgactagacATG

    AGR_C_1888 Gene: AGR_C_1888     GI: 15888368     BI number: AGR_C_1888     GOG: COG0840     Description: AGR_C_1888             c           c  g           a  g           t  t            At            Gc            Ta            Cg            Tg            Gc           G  a           C  |           A  |           G  |           A  |            Gc            Gc            Cg           |  c           |  t            Cg            Ta            Gc            Gt            At            At            Gt        aa            Ta       g  a           |  a       ta           |  a       ta           |  a       gc           |  c       cg            Cg        cg AG        Gc        tg G  A       Cg        gc GC        At        cg CG       C  c       gc CG       T  |       cg T  T       Gc        at GC        Cg        at GT        Gt        at                         ttgtttgtgccgacggccggagtaaaatttgcatttaaacttaacaaacatcaaatccggccagtcgaaattatatcttggttaattttagacgtgtctaaatcacgcaaagacaccagcgacatgaattggggtgtcagagcaggatgactagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................