                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-16.20 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-26.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAGCGCAGCGAACGGGAAAAACCCGTGCGCGGCCAGAAGAGGTCACGAATCTTCTCT
GAAAAACCAACGGGTTCACGGCGACGAAATGGCATggggtgcagtttatttcatcgcccgggccgcgccaagag
gttggtagacggcaaagaacttttgccggacattcttctcgccgtcgttccggcgttgagccggaatgttccgcggaacgggagtaagaaggatgctccc
gtcatggatgcgcgcttgttggtgcgcatccgcattgtttttctggcagagcacgagaccgcgtcacaATG

    AGR_C_1899 Gene: AGR_C_1899     GI: 15888373     BI number: AGR_C_1899     GOG: -------     Description: AGR_C_1899   t t  g g  a cg gc gc cg cg ta ta gt cg |  t        a |  t      a  g |  c      g  g |  c      a  a |  g       at |  c       tg |  g       gc |  g       at |  a       gc ta        gc        gt gc        gc       t  t cg        cg        tg cg        at        cg g  |      |  c       gt cg       |  a       cg ta       |  t       gc cg       |  g       cg |  t      a  g       gc ta       g  a       ta ta        gt        at cg        cg        gc ta        gc        gc ta        cg        tg                         cattgtttttctggcagagcacgagaccgcgtcacaATG     ..................................................................................................................