                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-15.10 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -6.36 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATCAAGGCGATCTCCACCGCCTCGCGCAAGGAGCTGTCAGAAATCCTCGAGCAGCC
GGTGCATCTCTTCCTGTTCGTGAAGGTCCGCGAGAACTGGGGCGACGACCCCGAGCGC
TTCCGTGAAATGGGTCTGGAATTCCCGCGGGGTTAAcgcacgctcggttttccccggcacctcattcctgtga
caagcgcaggaatgaggtgggaatatcttcgtctaccaccgggaaccgaacacgttcgggccggttgttccaaaacaattgggcgcaacctttttttgat
gatggatattcATG

    AGR_C_1912 Gene: AGR_C_1912     GI: 15888379     BI number: AGR_C_1912     GOG: COG0664     Description: AGR_C_1912            ac           c  g            at            at         c            gc       a  a   t        cg       a  a c  t       cg        at t  c      a  g       at a  g      a  |       cg t  t      g  |       cg a  c       gc        tg a  t       gc       |  c g  a       cg        tg gc        cg        gc gc        at        ta ta       c  t       ta gc        cg        gc gc        at        gc                         tttttttgatgatggatattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0664 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases ... can be seen here     ..................................................................................................................