                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACACTCGGTCTTTCGATCGTCCACACCAATAAGACCCTGAGAAAGCTGGTCGATCGCG
GCCTCATTCGCTGGATTGACAAGGGTTGCCTGGTGCTGGACGAGGCAGGCTTGAGCCA
TGTGGCGGGCTGGGAAAGCGACGAAAAGCGGCAAAGGCCGTTCATCTGAttgttttacgacatg
tcttttttaaatgacggtgaggccgcaatttgcgactgctgtgatcatatctcccgcgagaattatactggagactgcttttttttagccatgcggtctc
gtcattaggatgaaaaaattATG

    AGR_C_1913 --- AGR_C_1915 Gene: AGR_C_1913     GI: 15888380     BI number: AGR_C_1913     GOG: COG0784     Description: AGR_C_1913p Gene: AGR_C_1915     GI: 15888381     BI number: AGR_C_1915     GOG: COG1381     Description: AGR_C_1915             G           G  A           G  A            TA            CG            GC           |  G           G  A            GC            CG           G  A           G  A           T  A       AA           G  A      A  G           T  G       CG           A  C       GC TG        CG        GC G  G       CG        CG T  C       GC        GT A  G      A  A       AT CG       G  |      A  C CG        TA       A  A GC        TA        AT AT        CG        GC                         TGAttgttttacgacatgtcttttttaaatgacggtgaggccgcaatttgcgactgctgtgatcatatctcccgcgagaattatactggagactgcttttttttagccatgcggtctcgtcattaggatgaaaaaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0784 FOG: CheY-like receiver ... can be seen here [L] COG1381 Recombinational DNA repair protein (RecF pathway) ... can be seen here     ..................................................................................................................