Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGTTAAATTGCGGTATTGGGTGCGCAGCGACAACTATTTCGTAACGACGCGCGACG
TGACAAAAGCCATGCGGCTCGCTTTTGACGAACGCAAGGCCGAGGTAAACGCACAGCC
TGCCTGAggcctgacggttaatcctgcccgcatattttaagcgcggtggctgaacagccatcgcgtttttcatgacccgacgtcaacacccaccc
ttgcatcctgccaaagacgcctctataggtcgaaatgtaatgttattacgttacttgtttttgatcgcagactgaagagggccgaaacaATG

    AGR_C_1935


Gene: AGR_C_1935     GI: 15888391     BI number: AGR_C_1935     GOG: COG3443     Description: AGR_C_1935



  t
t  t
a  t       aa
t  a      g  c
a  a       ta
 cg        cg
 gc        gc
 cg        gc
|  c       ta
 cg        gt
 cg        gc
 gt        cg
 tg        gc
 cg        cg
            tttttcatgacccgacgtcaacacccacccttgcatcctgccaaagacgcctctataggtcgaaatgtaatgttattacgttacttgtttttgatcgcagactgaagagggccgaaacaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG3443 Predicted periplasmic or secreted protein ... can be seen here

    ..................................................................................................................