                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:71 nt.    Distance to gene:9 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-16.70 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=27 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:    Distance from promoter:29 nt.    Size=36 nt.     Delta G= -4.89 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaacg-tacaat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaacggccgcccggcggctcgttacaattttaagtgtatattaatacagatttaacagcggcatcgttccacccgctcttttcatggccccgcgactga
tcctgtgccagcctctccagaggcgttggtggtgcggaattttcttctgcagccATG

    AGR_C_1971 Gene: AGR_C_1971     GI: 15888410     BI number: AGR_C_1971     GOG: COG0768     Description: AGR_C_1971                      cc                     t  a                      cg                      ta gc                  cg c  t                 cg c  c                 gc c  t                |  g a  t       ga       |  t c  t      t  t      |  t c  t      c  c      |  g t  c      a  c      |  g ta        gt        at gt        cg        cg cg        gt        cg tg        cg        gt a  c      |  c       tg c  c      c  c       gc gc       c  a      t  | gc        cg        cg cg        gc        cg gc        gc        ta                         attttcttctgcagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0768 Cell division protein FtsI/penicillin-binding protein 2 ... can be seen here     ..................................................................................................................